STUDYSHIELDS ASSIGNMENT HELP

  • Home
  • Blog
  • Courses
    • Child Category 1
    • Child Category 2
    • Child Category 3
    • Child Category 4
  • Services
  • Country
    • Childcare
    • Doctors
  • Home
  • Blog
  • Sample Works
  • Order Now

Tuesday, November 23, 2021

For the gene annotation assignment, you will be assigned unknown DNA sequence

 November 23, 2021     No comments   

 For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.


Must include screenshots at each step


Identify the open reading frame (ORF). Must describe the frame strand, positive or negative, frame 1, 2 or 3, what it means,

List the top three hits providing statistics such as, e-value, identity score, length etc. use the top hit to describe how the query aligns with the subject including the definitions as necessary. Use screenshot to explain.

Coding Sequence (CDS) Coding regions. State the coordinates of the start and stop codon. Or state if the gene is protein coding or not

Genomic location: State the chromosome on which the gene is found and location

List of exons

What is the gene name, organism, and gene id encoded by this DNA sequence? You can use any of the genomic browsers already covered. Explain why you concluded the sequence belong to the gene you have named.

Do not cut and paste your database results to report your findings. Write two to three paragraphs reporting the information you have obtained about this gene. Imagine this is a report you will present to an employer or a group of researchers interested in this gene.




here is the sequence:


 


ATGGACGGCCCCGGGGCCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGAAGTGCC


TGCGCCTGGACCCGACCGCGCCCGTGTGGGCCGCCAAGCAGCGCGTGCTCTGCGCCCTCAACCACAGCCT


CCAGGACGCGCTCAACTATGGGCTTTTCCAGCCGCCCTCCCGGGGCCGCGCCGGCAAGTTCCTGGACGAG


GAGCGGCTCCTGCAGGACTACCCGCCTAATCTGGACACGCCCCTGCCCTACCTGGAGTTTCGATACAAGC


GGCGAGTTTATGCCCAGAACCTCATCGATGATAAGCAGTTTGCAAAGCTTCACACAAAGGCGAACCTGAA


GAAGTTCATGGACTATGTCCAGCTGCATAGCACAGACAAGGTGGCCCGCCTGCTGGACAAGGGGCTGGAC


CCCAACTTCCATGACCCTGACTCAGGAGAGTGCCCCCTGAGCCTTGCAGCCCAGCTGGACAATGCCACGG


ACCTGCTGAAGGTGCTGAAGAACGGCGGTGCCCACCTGGACTTTCGCACTCGTGATGGGCTCACTGCTGT


GCACTGTGCCACACGCCAGCGGAATGCAGCGGCATTGACGACCCTGCTGGACCTGGGGGCATCACCTGAC


TACAAGGACAGCCGCGGCTTGACACCCCTCTACCACAGCGCCCTGGGGGGTGGGGATGCCCTCTGCTGTG


AGCTGCTTCTCCACGACCATGCTCAGCTGGGGACCACCGACGAGAATGGCTGGCAGGAGATCCACCAGGC


CTGCCGCTTCGGGCACGTGCAGCACCTGGAGCACCTGCTCTTCTACGGGGCAGACATGGGGGCCCAGAAC


GCCTCAGGGAACACAGCCCTGCACATCTGTGCCCTCTACAACCAGGAGAGCTGTGCTCGTGTCCTGCTCT

  • Share This:  
  •  Facebook
  •  Twitter
  •  Google+
  •  Stumble
  •  Digg
Email ThisBlogThis!Share to XShare to Facebook

Related Posts:

  • MGT 445 Communication and Personality in Negotiation PaperMGT 445 Communication and Personality in Negotiation PaperUsing the selected concepts and terms from your selected readings, prepare a 1,050-1,750- wo… Read More
  • Information System, BusinessInformation System, BusinessWhy do contemporary information systems technology and the Internet pose challenges to the protection of individual privac… Read More
  • Gannon Company establishesGannon Company establishesGannon Company establishes a $400 petty cash fund on September 9. On September 30, the fund shows $166 in cash along with re… Read More
  • Respond to a RFP using the same firm and scenario from the first and second assignments.Respond to a RFP using the same firm and scenario from the first and second assignments.Write a four to six (4-6) page paper in which you:1. Review th… Read More
  • Bus 661- Organizational Change Report, Bridgepoint EducationBus 661- Organizational Change Report, Bridgepoint EducationFocus of the Organizational Change Report8-10 page paper (excluding appendixes, cover page… Read More
Newer Post Older Post Home

0 comments:

Post a Comment

Click Here to Place order

Popular Posts

  • A “criminal minds” Aileen Wournos individual will be your “patient”
     A “criminal minds” Aileen Wournos individual will be your “patient”  A brief history of the patient including diagnoses (documented or your...
  • CEO Jane Lionel has some hard decisions to make with regard to some of the company’
     CEO Jane Lionel has some hard decisions to make with regard to some of the company’solder hands, and even on the eve of that decision, I be...
  • Problem in Supply Chain
    Problem in Supply Chain Problem 2. (Chapter 11: The Storage and Handling System) Compare the constrast private ownership of storage space to...

Recent Posts

Unordered List

Pages

  • Home

Text Widget

Blog Archive

  • November 2022 (20)
  • October 2022 (50)
  • September 2022 (119)
  • August 2022 (107)
  • February 2022 (501)
  • January 2022 (443)
  • December 2021 (488)
  • November 2021 (1574)
  • October 2021 (28)
  • September 2021 (11)
  • July 2021 (8)
  • June 2021 (15)
  • May 2021 (39)
  • April 2021 (15)
  • March 2021 (303)
  • February 2021 (712)
  • January 2021 (903)
  • December 2020 (2)
  • September 2020 (33)
  • April 2016 (5183)
  • March 2016 (3763)
  • February 2016 (4356)
  • January 2016 (1749)
  • December 2015 (22)
  • November 2015 (147)
  • October 2015 (23)

Sample Text

Copyright © 2025 STUDYSHIELDS ASSIGNMENT HELP | Powered by Blogger
Design by Hardeep Asrani | Blogger Theme by NewBloggerThemes.com | Distributed By Gooyaabi Templates